to top page


TOP > February 2012 >Basidiomycota >1099

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1099February 2012BasidiomycotaUncultured basidiomyceteAM901849
97
4557
319
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAACGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGAAGCTCGGAATGCGCGTTCGGTCTGATGCTGCCCGGCAACGGGATGTGCTCGGCCGGATGCGTGTCCCTTCTCTATTCCACCCCGTTTGTGAACCCAAGTGTGCGAGCCGAAGAGAGATCGGAGGCTCGCATGCAACCCGTTAACATACCCCGAATGAACGTATCAGAATGTACCTTGCGTTAACTCGCACAAACTACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAACGAACGCAG