to top page


TOP > February 2012 >Basidiomycota >1098

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1098February 2012BasidiomycotaUncultured basidiomyceteAM901992
99
43
310
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAACGGGTTGTCTGCTGGCTCGCAAGGGCATGTGCACGCCTGTCTCATCCACTCTCAACTTCTGTGCACTTTTCATAGGCCGGCTTGTGGGTGCGTTCGCGCACTTGTAGGTGTCGGGCTTATGCTTTATTACAAACGATTCAGTTTTAGAATGTCATACTTTGCTATAACGCAATTTATATACAACTTTCAGCAACGGATCTCTTGGCTTCTCGCATCGATGAAGAACGCAG