to top page


TOP > February 2012 >Basidiomycota >1097

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1097February 2012BasidiomycotaUncultured basidiomyceteAM902098
91
1
312
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGGAAATCGAAGCGGGCTGCTGCTGGCCTCAGTCATGTGCCGAGGCATGTGCGCGCTCGTTCTCGTCCGCTCACACCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTAACGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAGTATCAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG