to top page


TOP > February 2012 >Basidiomycota >1096

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1096February 2012BasidiomycotaTrametes sp.EU780685
97
1
306
-

Sequence

CTTGGTCATTTTAGAGGAAGTAAAAAGTCGTAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGGATCATTAACGAGTTTTTGAAACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTGCCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTTGCGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAACGTATCAGAATGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG