to top page


TOP > February 2012 >Basidiomycota >1095

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1095February 2012BasidiomycotaTrametes sp.EU780685
99
112
304
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAGTTTTGAAACGAGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCTCTGCTCATCCACTCTACCCCTGTGCACTTACTGTAGGTTGGCGTGGGCTCCTTTGCGGGAGCATTCTGCCGGCCTATGTATACTACAAACACTTTAAAACGTATCAGAACTGTAAACGCGTCTAACGCATCTATAATACAACTTTTAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG