to top page


TOP > February 2012 >Basidiomycota >1094

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1094February 2012BasidiomycotaTomentella sp.JQ711817
97
51
319
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAACTGTCGACACGAGCTGTTGCTGGCCCTTGAAAAGGGGGGCACGTGCACGCTCTGTTTACACATCCACTCACGCCTGTGCACCCTCTGTAGTTCTATGGCCTTGGGGACCCCCGTCTCCTTGCTGTGGTCCTACGTCTTTACACACACACCATAACAAAGTCTCATGGAATGTACGCCGCGTTTAACGCAATACAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG