to top page


TOP > February 2012 >Basidiomycota >1093

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1093February 2012BasidiomycotaTermitomyces sp.HM569614
96
1
319
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGCGAAGGCTCGGAACGCGTAGTTCGGTACTGTAGCGTGCCCAGCGATGGGATGTGCTCGTCTGGATGCGTGTCCCCTTCTCTAATTCCACCCCACTGTAGAACCCAAGCGTGTGAGCCGAAGAGATATCGGAGGCTTGCACGCAACACTTAACATACCCCAATGAAGTATCAGAATGTACCTTGCGTTAACTCGCACAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG