to top page


TOP > February 2012 >Basidiomycota >1092

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1092February 2012BasidiomycotaPseudozyma aphidisAF294699
98
9
348
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTATCTGTAGGTGAACCTGCAGATGGATCATTTCGATGAAAACCTTTTTTTCTTGAGGTGTGGCTCGCACCTGTCTAACTAAATCGAGCTACCACATTTTAACACGGTTGCATCGGTTGGCTGTCAAACAGTGCGCGCGGCGATTTATTTCGCCTCCCCGCGCATTGCGAGACGGTCGACATTTACCAAAAACACTGTTGGTACCATAGGATTTGAACGTAGATGAAACTCGACTGGTAATGCGGTCGTCTAAAACTCTAAAAACAACTTTTGACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAG