to top page


TOP > February 2012 >Basidiomycota >1091

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1091February 2012BasidiomycotaOligoporus balsameusAY599566
98
1
299
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTTTTGAAGGAGCTGTTTGCTGGCCCTCAGCGGGGCATGTGCACGCTCCGTTCAAATCCAACCTTCATACCCCTGTGCACTCTTTGTAGGGTCGTGGCTGCGAGGCTGCGCTCTATGTTCATCATAAACCTCTTCAGTATGTGTAGAATGTTCATTGCGTGTAACGCATCTTTAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG