to top page


TOP > February 2012 >Basidiomycota >1090

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1090February 2012BasidiomycotaEntoloma clypeatum f. hybridumAB520858
98
3
348
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATTGAATTAACTTGGTTGGGTTGTTGCTGGCTTTTAGAAGCATGTGCACATCCACTCCATTTTCAACCAACTGTGCACACATTGTAGGCTCGAAACTCTCGAGGACACTCGGTTTGAGAATTGCTCTTAAAATGCGGCTTTTCTTGCATTTCAGGTCTATGTTTTTAATATACTCCATATGAATGTAACAGAATGTTTATTAAGGGCCTTTTTAGTGCCTGTAAAACAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG