to top page


TOP > February 2012 >Basidiomycota >1089

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1089February 2012BasidiomycotaDaedaleopsis confragosaFR686551
98
9
318
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAGCCTGCGGAAGGATCATTAACGAGTTTTGAAAGGGGTTGTAGCTGGCCTTCCGAGGCATGTGCACGCCCTGCTCATTCCACTCTAACACCTGTGCACTTACTGTGGGTCTCAGGCGAGCGTCGGTCGCTTCGCGGCGTCGTCGTTCAACTGGGCTCACGTTTTAACTACAAACTATTAAACGTATCAGAATGTCTACTGCGAATTAACGCATTTAAACTACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG