to top page


TOP > February 2012 >Basidiomycota >1088

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1088February 2012BasidiomycotaCryptococcus terricolaHE863717
99
30
282
-

Sequence

CTTGGTCATTTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATTGAATATGTTAGCGGACCTCTTTCGGAGTCCCTAGCATCAAATCATATCCATAACACCTGTGAACTGTAAGGCTGTCTTGAAAACGAAAGTGATTAGAGCGCCTGCCCATTTTATACAAACATTAAAGTAACAAACGTAGTCTTATTATAATCTAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG