to top page


TOP > February 2012 >Basidiomycota >1087

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1087February 2012BasidiomycotaBjerkandera fumosaAJ006673
99
1
346
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAACGGGTTGTCTGCTGGCTCGCGAGAGCATGTGCACGCCTGTCTTCATCCACTCTCAACTTCTGTGCACTTTTCATAGGCCGGCTTGTGGGTGCACGTTCGCGTGTGTCTGTAGGTCTGGTTTATGCTTTATACTACAAACGAATCAGTTTTAGAATGTCATACTTTGCTATAACGCAATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCCGTAGCGGCGGTCGTCGACGACGGCGACTAGT