to top page


TOP > February 2012 >Basidiomycota >1086

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1086February 2012BasidiomycotaBjerkandera adustaAB733156
99
16
313
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAACGGGTTGTCTGCTGGCTCGCGAGAGCATGTGCACGCCTGTCTTCATCCACTCTCAACTTCTGTGCACTTTTCATAGGCCGGCTTGTGGGTGCACGTTCGCGTGTGTCTGTAGGTCTGGTTTATGCTTTATACTACAAGCGAATCAGTTTTAGAATGTCATACTTTGCTATAACGCAATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG