to top page


TOP > February 2012 >Basidiomycota >1085

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1085February 2012BasidiomycotaBjerkandera adustaAB733156
98
1
309
-

Sequence

CTTGGTCATTAGAGGAAGTAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAGTTTTGAACGGGTTGTCTGCTGGCTCGCAAGGGCATGTGCACGCCTGTCTCATCCACTCTCAACTTCTGTGCACTTTTCATAGGCCGGCTTGTGGGTGCACGTTCGCGTGTGTCTGTAGGTCTGGTTTATGCTTTATACTACAACGAATCAGTTTTAGAATGTCATACTTTGCCATAACGCAATTATATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG