to top page


TOP > February 2012 >Basidiomycota >1084

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1084February 2012BasidiomycotaAstraeus hygrometricusAB507396
96
3
332
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAATCTCGGCCCGGGGGGGGGGTATGTCTAGTAGTATTTCGGAGTGCTGTCGCTGGCCTTCGGGCAAAATGTGCACGTCTCCGGAGTCCGACGGCGTCCCCTCACCGATGCCTCTCTCCAAACACCTGTGTGCACCTGTTGTAGGTCTCGTCACTGGGACCTATGCATTCCATATAAACTCGCATGTATACAGAACGTTGTCCAAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG