to top page


TOP > February 2012 >Basidiomycota >1083

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1083February 2012BasidiomycotaAstraeus hygrometricusAB507396
94
1
341
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAATCTCGGCCCCGGGGGGGGGGTAGGTGTCTAGTAGTATTTCGGTAGTGCTGTCGCTGGCCTTCGGGTCGAAAACTAGTGCACGTCTCCGGAGTCCGACGGCGTCCCCTCACCGATGCCTCTCTCCAAACACCTGTGTGCACCTGTTGTAGGTCTCGTCACTGGGACCTATGTATTCCATATAAACTCGCATGTATACAGAACGTTGTCCAAACTATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG