to top page


TOP > February 2012 >Basidiomycota >1082

id collected on Phylum Blast Match/clone name Accession no. Identity (%) Total no. of clone ITS-size(bp) similarity (%)
1082February 2012BasidiomycotaAstraeus hygrometricusAB507396
97
4
330
-

Sequence

CTTGGTCATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAATCTCGGCCCGGGGGGAGTGTCTAGTAGTATTTCGGTAGTGCTGTCGCTGGCCTTCGGGTCGAAATAGTGCACGTCTCCGGAGTCCGACGGCGTCCCCTCACCGATGCCTCTCCAAACACACCTGTGTGCACCTGTTGTAGGTCTCGTCACTGGGACCTATGTATTCCATATAAACTCGCATGTATACAGAACGTTGTCCAATATAATATAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAG